Basic information for FTX-217-10aa-4
| Peptide Name | FTX-217-10aa-4 |
| Genome Position | chrX:74008871-74008900[-] |
| Species | Human |
| Peptide Sequence | MSGLSCSTGQ |
| Peptide Length | 10 |
| Unique | No (FTX-213-10aa-4,FTX-214-10aa-5,FTX-215-10aa-3,FTX-220-10aa) |
| Grand Average of Hydropathicity | 0.08 |
| Relative Molecular Mass | 1132.26 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000230590;FTX |
| Transcript ID/Name | ENST00000639539;FTX-217 |
| Transcript Length | 11469 |
| Coding Ability | 0.4236 |
| DNA Sequence Corresponding to Peptide | ATGTCTGGGCTTTCCTGTTCCACTGGTCAG |
|
Conservation
|
|
|