Basic information for FTX-239-10aa-1
| Peptide Name | FTX-239-10aa-1 |
| Genome Position | chrX:74247812-74247841[-] |
| Species | Human |
| Peptide Sequence | MLLLIAYTFY |
| Peptide Length | 10 |
| Unique | No (FTX-242-10aa-4) |
| Grand Average of Hydropathicity | 1.91 |
| Relative Molecular Mass | 1409.71 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000230590;FTX |
| Transcript ID/Name | ENST00000656041;FTX-239 |
| Transcript Length | 3400 |
| Coding Ability | 0.3688 |
| DNA Sequence Corresponding to Peptide | ATGCTTTTGTTAATTGCTTATACATTTTAT |
|
Conservation
|
|
|