Basic information for FTX-242-10aa-1
| Peptide Name | FTX-242-10aa-1 |
| Genome Position | chrX:74245556-74245585[-] |
| Species | Human |
| Peptide Sequence | MASCCPNTIY |
| Peptide Length | 10 |
| Unique | No (FTX-239-10aa-2,FTX-249-10aa,FTX-262-10aa-1,FTX-270-10aa,FTX-271-10aa) |
| Grand Average of Hydropathicity | 0.53 |
| Relative Molecular Mass | 1264.48 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000230590;FTX |
| Transcript ID/Name | ENST00000657327;FTX-242 |
| Transcript Length | 3307 |
| Coding Ability | 0.4143 |
| DNA Sequence Corresponding to Peptide | ATGGCTAGCTGTTGTCCCAATACTATTTAC |
|
Conservation
|
|
|