Basic information for FTX-268-10aa-2
| Peptide Name | FTX-268-10aa-2 |
| Genome Position | chrX:74261274-74261303[-] |
| Species | Human |
| Peptide Sequence | MGHGKILNFL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.54 |
| Relative Molecular Mass | 1291.52 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSG00000230590;FTX |
| Transcript ID/Name | ENST00000669263;FTX-268 |
| Transcript Length | 2488 |
| Coding Ability | 0.502 |
| DNA Sequence Corresponding to Peptide | ATGGGCCACGGAAAGATTCTAAACTTCTTG |
|
Conservation
|
|
|