Basic information for Ftx-206-10aa
| Peptide Name | Ftx-206-10aa |
| Genome Position | chrX:103605547-103605576[-] |
| Species | Mouse |
| Peptide Sequence | MHEPAHLCLC |
| Peptide Length | 10 |
| Unique | No (Ftx-204-10aa-2,Ftx-205-10aa-1,Ftx-207-10aa-2,Ftx-208-10aa-1,Ftx-209-10aa-1,Ftx-210-10aa-1,Ftx-211-10aa-2,Ftx-212-10aa-1) |
| Grand Average of Hydropathicity | 0.48 |
| Relative Molecular Mass | 1315.54 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000086370;Ftx |
| Transcript ID/Name | ENSMUST00000156240;Ftx-206 |
| Transcript Length | 2313 |
| Coding Ability | 0.5352 |
| DNA Sequence Corresponding to Peptide | ATGCACGAACCTGCCCATCTTTGCCTCTGT |
|
Conservation
|
|
|