Basic information for GRIK1-AS1-206-10aa-4
| Peptide Name | GRIK1-AS1-206-10aa-4 |
| Genome Position | chr21:29763767-29763796[+] |
| Species | Human |
| Peptide Sequence | MTVVNTIEEI |
| Peptide Length | 10 |
| Unique | No (GRIK1-AS1-201-10aa,GRIK1-AS1-202-10aa,GRIK1-AS1-203-10aa,GRIK1-AS1-204-10aa) |
| Grand Average of Hydropathicity | 0.74 |
| Relative Molecular Mass | 1310.55 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSG00000174680;GRIK1-AS1 |
| Transcript ID/Name | ENST00000658262;GRIK1-AS1-206 |
| Transcript Length | 4210 |
| Coding Ability | 0.3176 |
| DNA Sequence Corresponding to Peptide | ATGACTGTTGTTAATACAATTGAGGAAATA |
|
Conservation
|
|
|