Basic information for Gm10461-201-10aa-1
| Peptide Name | Gm10461-201-10aa-1 |
| Genome Position | chr5:32610311-32610340[-] |
| Species | Mouse |
| Peptide Sequence | MVDLFSLPLN |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.09 |
| Relative Molecular Mass | 1310.5 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000107277;Gm10461 |
| Transcript ID/Name | ENSMUST00000202073;Gm10461-201 |
| Transcript Length | 4786 |
| Coding Ability | 0.4133 |
| DNA Sequence Corresponding to Peptide | ATGGTGGATTTGTTTTCCCTTCCTCTCAAC |
m6A
|
Conservation
|
|
|