Basic information for Gm10687-201-10aa
| Peptide Name | Gm10687-201-10aa |
| Genome Position | chr9:44123852-44123881[-] |
| Species | Mouse |
| Peptide Sequence | MRYDALFWGV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.39 |
| Relative Molecular Mass | 1419.59 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097617;Gm10687 |
| Transcript ID/Name | ENSMUST00000180670;Gm10687-201 |
| Transcript Length | 3233 |
| Coding Ability | 0.3876 |
| DNA Sequence Corresponding to Peptide | ATGAGATATGATGCTCTTTTCTGGGGTGTC |
|
Conservation
|
|
|