Basic information for Gm11525-201-10aa
| Peptide Name | Gm11525-201-10aa |
| Genome Position | chr11:96921918-96921947[-] |
| Species | Mouse |
| Peptide Sequence | MVSGIRGNLP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.32 |
| Relative Molecular Mass | 1205.38 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000085307;Gm11525 |
| Transcript ID/Name | ENSMUST00000134436;Gm11525-201 |
| Transcript Length | 2804 |
| Coding Ability | 0.4258 |
| DNA Sequence Corresponding to Peptide | ATGGTTTCTGGCATCCGTGGTAATCTACCA |
|
Conservation
|
|
|