Basic information for Gm12256-201-10aa
| Peptide Name | Gm12256-201-10aa |
| Genome Position | chr11:58891242-58891271[+] |
| Species | Mouse |
| Peptide Sequence | MLCVYGGLTS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.26 |
| Relative Molecular Mass | 1205.44 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000087654;Gm12256 |
| Transcript ID/Name | ENSMUST00000132394;Gm12256-201 |
| Transcript Length | 446 |
| Coding Ability | 0.352 |
| DNA Sequence Corresponding to Peptide | ATGCTCTGCGTGTATGGGGGGCTCACTAGT |
m6A
|
Conservation
|
|
|