Basic information for Gm13986-201-10aa-1
| Peptide Name | Gm13986-201-10aa-1 |
| Genome Position | chr2:118071408-118071437[-] |
| Species | Mouse |
| Peptide Sequence | MLQARSNASV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.04 |
| Relative Molecular Mass | 1238.36 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000087203;Gm13986 |
| Transcript ID/Name | ENSMUST00000138764;Gm13986-201 |
| Transcript Length | 2562 |
| Coding Ability | 0.4457 |
| DNA Sequence Corresponding to Peptide | ATGCTCCAGGCCAGAAGTAATGCTTCTGTC |
|
Conservation
|
|
|