Basic information for Gm14144-201-10aa-3
| Peptide Name | Gm14144-201-10aa-3 |
| Genome Position | chr2:151265418-151265447[-] |
| Species | Mouse |
| Peptide Sequence | MELLTWLEHL |
| Peptide Length | 10 |
| Unique | No (4930442J19Rik-202-10aa-3) |
| Grand Average of Hydropathicity | 0.53 |
| Relative Molecular Mass | 1446.69 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000087337;Gm14144 |
| Transcript ID/Name | ENSMUST00000128602;Gm14144-201 |
| Transcript Length | 1721 |
| Coding Ability | 0.4521 |
| DNA Sequence Corresponding to Peptide | ATGGAGCTCCTCACTTGGCTGGAACATTTG |
m6A
|
Conservation
|
|
|