Basic information for Gm15218-201-10aa
| Peptide Name | Gm15218-201-10aa |
| Genome Position | chr14:45993099-45993128[+] |
| Species | Mouse |
| Peptide Sequence | MEKLFLEFNL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.45 |
| Relative Molecular Mass | 1445.67 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000085866;Gm15218 |
| Transcript ID/Name | ENSMUST00000131006;Gm15218-201 |
| Transcript Length | 618 |
| Coding Ability | 0.199 |
| DNA Sequence Corresponding to Peptide | ATGGAGAAGCTTTTCCTCGAGTTTAACCTT |
|
Conservation
|
|
|