Basic information for Gm15581-201-10aa-2
| Peptide Name | Gm15581-201-10aa-2 |
| Genome Position | chr6:17211293-17211322[-] |
| Species | Mouse |
| Peptide Sequence | MTDIFHFCKL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.7 |
| Relative Molecular Mass | 1416.7 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000085264;Gm15581 |
| Transcript ID/Name | ENSMUST00000131334;Gm15581-201 |
| Transcript Length | 5640 |
| Coding Ability | 0.4365 |
| DNA Sequence Corresponding to Peptide | ATGACTGACATATTTCACTTTTGCAAACTC |
|
Conservation
|
|
|