Basic information for Gm16759-204-10aa-1
| Peptide Name | Gm16759-204-10aa-1 |
| Genome Position | chr9:63493029-63493058[+] |
| Species | Mouse |
| Peptide Sequence | MSQCLFELTL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.01 |
| Relative Molecular Mass | 1346.6 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000086539;Gm16759 |
| Transcript ID/Name | ENSMUST00000191455;Gm16759-204 |
| Transcript Length | 4272 |
| Coding Ability | 0.4338 |
| DNA Sequence Corresponding to Peptide | ATGAGTCAATGCCTCTTTGAGCTCACCTTG |
|
Conservation
|
|
|