Basic information for Gm17200-201-10aa
| Peptide Name | Gm17200-201-10aa |
| Genome Position | chr9:123700401-123700430[+] |
| Species | Mouse |
| Peptide Sequence | MVTWSLHQIT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.46 |
| Relative Molecular Mass | 1377.64 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000090608;Gm17200 |
| Transcript ID/Name | ENSMUST00000170214;Gm17200-201 |
| Transcript Length | 2022 |
| Coding Ability | 0.3007 |
| DNA Sequence Corresponding to Peptide | ATGGTGACTTGGAGTCTACACCAGATCACC |
m6A
|
Conservation
|
|
|