Basic information for Gm17494-202-10aa-3
| Peptide Name | Gm17494-202-10aa-3 |
| Genome Position | chr3:122292672-122292701[-] |
| Species | Mouse |
| Peptide Sequence | MHLQFTPLST |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.18 |
| Relative Molecular Mass | 1336.59 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000057359;Gm17494 |
| Transcript ID/Name | ENSMUST00000199060;Gm17494-202 |
| Transcript Length | 6844 |
| Coding Ability | 0.4281 |
| DNA Sequence Corresponding to Peptide | ATGCATCTTCAGTTTACACCACTTTCAACT |
m6A
|
Conservation
|
|
|