Basic information for Gm1976-202-10aa-2
| Peptide Name | Gm1976-202-10aa-2 |
| Genome Position | chr17:94761098-94761127[-] |
| Species | Mouse |
| Peptide Sequence | MDGLVVKSTD |
| Peptide Length | 10 |
| Unique | No (Gm1976-203-10aa-1) |
| Grand Average of Hydropathicity | 0.13 |
| Relative Molecular Mass | 1226.39 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000066057;Gm1976 |
| Transcript ID/Name | ENSMUST00000182639;Gm1976-202 |
| Transcript Length | 1853 |
| Coding Ability | 0.5478 |
| DNA Sequence Corresponding to Peptide | ATGGATGGCTTAGTGGTTAAGAGCACTGAC |
m6A
|
Conservation
|
|
|