Basic information for Gm20546-201-10aa-1
| Peptide Name | Gm20546-201-10aa-1 |
| Genome Position | chr17:36253483-36253512[+] |
| Species | Mouse |
| Peptide Sequence | MQLRNVFFVS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.74 |
| Relative Molecular Mass | 1402.62 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000092392;Gm20546 |
| Transcript ID/Name | ENSMUST00000173141;Gm20546-201 |
| Transcript Length | 1889 |
| Coding Ability | 0.5204 |
| DNA Sequence Corresponding to Peptide | ATGCAGCTGAGGAATGTGTTCTTTGTATCT |
m6A
|
Conservation
|
|
|