Basic information for Gm20557-201-10aa-2
| Peptide Name | Gm20557-201-10aa-2 |
| Genome Position | chr3:49367308-49367337[+] |
| Species | Mouse |
| Peptide Sequence | MVYIKHSYLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.77 |
| Relative Molecular Mass | 1428.69 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000102679;Gm20557 |
| Transcript ID/Name | ENSMUST00000192871;Gm20557-201 |
| Transcript Length | 2794 |
| Coding Ability | 0.4714 |
| DNA Sequence Corresponding to Peptide | ATGGTGTACATTAAGCATTCTTATCTATTA |
|
Conservation
|
|
|