Basic information for Gm20628-201-10aa-1
| Peptide Name | Gm20628-201-10aa-1 |
| Genome Position | chr3:96269217-96269246[-] |
| Species | Mouse |
| Peptide Sequence | MYGAPAFPSV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.68 |
| Relative Molecular Mass | 1201.34 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000093656;Gm20628 |
| Transcript ID/Name | ENSMUST00000177363;Gm20628-201 |
| Transcript Length | 3215 |
| Coding Ability | 0.4047 |
| DNA Sequence Corresponding to Peptide | ATGTATGGCGCTCCCGCCTTTCCTTCTGTC |
m6A
|
Conservation
|
|
|