Basic information for Gm26513-201-10aa
| Peptide Name | Gm26513-201-10aa |
| Genome Position | chr15:98095681-98095710[+] |
| Species | Mouse |
| Peptide Sequence | MLSHLPPSLL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.91 |
| Relative Molecular Mass | 1269.49 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097150;Gm26513 |
| Transcript ID/Name | ENSMUST00000181802;Gm26513-201 |
| Transcript Length | 2489 |
| Coding Ability | 0.4178 |
| DNA Sequence Corresponding to Peptide | ATGCTAAGTCACTTGCCTCCCTCATTACTC |
|
Conservation
|
|
|