Basic information for Gm26748-201-10aa-2
| Peptide Name | Gm26748-201-10aa-2 |
| Genome Position | chr6:99730630-99730659[+] |
| Species | Mouse |
| Peptide Sequence | MANQWLLVGL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.1 |
| Relative Molecular Mass | 1306.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097548;Gm26748 |
| Transcript ID/Name | ENSMUST00000180406;Gm26748-201 |
| Transcript Length | 2972 |
| Coding Ability | 0.3943 |
| DNA Sequence Corresponding to Peptide | ATGGCCAACCAGTGGCTTCTTGTTGGACTT |
|
Conservation
|
|
|