Basic information for Gm26876-201-10aa-3
| Peptide Name | Gm26876-201-10aa-3 |
| Genome Position | chr10:128648021-128648050[+] |
| Species | Mouse |
| Peptide Sequence | MSIIPLLAPL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.01 |
| Relative Molecular Mass | 1229.5 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000097372;Gm26876 |
| Transcript ID/Name | ENSMUST00000180875;Gm26876-201 |
| Transcript Length | 2387 |
| Coding Ability | 0.2401 |
| DNA Sequence Corresponding to Peptide | ATGTCAATAATTCCTTTGTTGGCTCCACTT |
|
Conservation
|
|
|