Basic information for Gm2762-202-10aa-3
| Peptide Name | Gm2762-202-10aa-3 |
| Genome Position | chr13:53455152-53455181[+] |
| Species | Mouse |
| Peptide Sequence | MILNACWKGL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.96 |
| Relative Molecular Mass | 1310.57 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000107008;Gm2762 |
| Transcript ID/Name | ENSMUST00000201517;Gm2762-202 |
| Transcript Length | 2339 |
| Coding Ability | 0.516 |
| DNA Sequence Corresponding to Peptide | ATGATTTTAAATGCTTGTTGGAAGGGTCTT |
|
Conservation
|
|
|