Basic information for Gm2762-207-10aa
| Peptide Name | Gm2762-207-10aa |
| Genome Position | chr13:53402628-53402657[+] |
| Species | Mouse |
| Peptide Sequence | MTVADLRSDC |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.12 |
| Relative Molecular Mass | 1272.43 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000107008;Gm2762 |
| Transcript ID/Name | ENSMUST00000202739;Gm2762-207 |
| Transcript Length | 2665 |
| Coding Ability | 0.3298 |
| DNA Sequence Corresponding to Peptide | ATGACTGTAGCTGACTTGAGGTCAGACTGC |
m6A
|
Conservation
|
|
|