Basic information for Gm28262-202-10aa-3
| Peptide Name | Gm28262-202-10aa-3 |
| Genome Position | chr8:7862532-7862561[+] |
| Species | Mouse |
| Peptide Sequence | MEVFISYHIT |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.84 |
| Relative Molecular Mass | 1401.62 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000099890;Gm28262 |
| Transcript ID/Name | ENSMUST00000192596;Gm28262-202 |
| Transcript Length | 5531 |
| Coding Ability | 0.4665 |
| DNA Sequence Corresponding to Peptide | ATGGAAGTATTTATCTCCTACCATATCACT |
|
Conservation
|
|
|