Basic information for Gm28262-202-10aa-5
| Peptide Name | Gm28262-202-10aa-5 |
| Genome Position | chr8:7860107-7860136[+] |
| Species | Mouse |
| Peptide Sequence | MCINYEKIFY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.27 |
| Relative Molecular Mass | 1485.72 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000099890;Gm28262 |
| Transcript ID/Name | ENSMUST00000192596;Gm28262-202 |
| Transcript Length | 5531 |
| Coding Ability | 0.4665 |
| DNA Sequence Corresponding to Peptide | ATGTGCATAAATTATGAAAAAATATTTTAT |
|
Conservation
|
|
|