Basic information for Gm28404-201-10aa-2
| Peptide Name | Gm28404-201-10aa-2 |
| Genome Position | chr1:105564367-105564396[-] |
| Species | Mouse |
| Peptide Sequence | MCFNLSCNLG |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.91 |
| Relative Molecular Mass | 1263.46 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000100672;Gm28404 |
| Transcript ID/Name | ENSMUST00000190242;Gm28404-201 |
| Transcript Length | 453 |
| Coding Ability | 0.3046 |
| DNA Sequence Corresponding to Peptide | ATGTGCTTTAATTTAAGTTGTAATTTGGGT |
m6A
|
Conservation
|
|
|