Basic information for Gm29480-201-10aa-1
| Peptide Name | Gm29480-201-10aa-1 |
| Genome Position | chr1:92845354-92845383[-] |
| Species | Mouse |
| Peptide Sequence | MCPDVSTSCF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.65 |
| Relative Molecular Mass | 1251.44 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000101995;Gm29480 |
| Transcript ID/Name | ENSMUST00000188589;Gm29480-201 |
| Transcript Length | 1655 |
| Coding Ability | 0.2804 |
| DNA Sequence Corresponding to Peptide | ATGTGTCCAGATGTCTCAACTTCCTGCTTC |
m6A
|
Conservation
|
|
|