Basic information for Gm29773-201-10aa-3
| Peptide Name | Gm29773-201-10aa-3 |
| Genome Position | chr8:123896491-123896520[+] |
| Species | Mouse |
| Peptide Sequence | MQISQLCVTA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.02 |
| Relative Molecular Mass | 1255.5 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000110547;Gm29773 |
| Transcript ID/Name | ENSMUST00000212751;Gm29773-201 |
| Transcript Length | 1895 |
| Coding Ability | 0.5293 |
| DNA Sequence Corresponding to Peptide | ATGCAGATTTCTCAGCTTTGCGTGACAGCA |
m6A
|
Conservation
|
|
|