Basic information for Gm29927-201-10aa-2
| Peptide Name | Gm29927-201-10aa-2 |
| Genome Position | chr13:102566098-102566127[-] |
| Species | Mouse |
| Peptide Sequence | MVLLSLVIPP |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 2.22 |
| Relative Molecular Mass | 1243.54 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000114846;Gm29927 |
| Transcript ID/Name | ENSMUST00000225128;Gm29927-201 |
| Transcript Length | 3602 |
| Coding Ability | 0.3784 |
| DNA Sequence Corresponding to Peptide | ATGGTTCTTCTCTCCTTAGTTATACCACCC |
|
Conservation
|
|
|