Basic information for Gm30382-202-10aa-2
| Peptide Name | Gm30382-202-10aa-2 |
| Genome Position | chr3:149285783-149285812[-] |
| Species | Mouse |
| Peptide Sequence | MYTLLYLKVS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.95 |
| Relative Molecular Mass | 1392.69 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000106515;Gm30382 |
| Transcript ID/Name | ENSMUST00000199007;Gm30382-202 |
| Transcript Length | 1801 |
| Coding Ability | 0.3815 |
| DNA Sequence Corresponding to Peptide | ATGTACACTCTTTTGTATTTGAAGGTCTCA |
|
Conservation
|
|
|