Basic information for Gm30948-201-10aa-2
| Peptide Name | Gm30948-201-10aa-2 |
| Genome Position | chr12:115284016-115284045[+] |
| Species | Mouse |
| Peptide Sequence | MAFLRIKFHY |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.47 |
| Relative Molecular Mass | 1487.76 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000103168;Gm30948 |
| Transcript ID/Name | ENSMUST00000195683;Gm30948-201 |
| Transcript Length | 4827 |
| Coding Ability | 0.5115 |
| DNA Sequence Corresponding to Peptide | ATGGCATTTTTAAGGATCAAATTCCATTAT |
|
Conservation
|
|
|