Basic information for Gm32369-201-10aa
| Peptide Name | Gm32369-201-10aa |
| Genome Position | chr12:70676726-70676755[-] |
| Species | Mouse |
| Peptide Sequence | MVTSLSLYNS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.58 |
| Relative Molecular Mass | 1276.44 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000112950;Gm32369 |
| Transcript ID/Name | ENSMUST00000222630;Gm32369-201 |
| Transcript Length | 1467 |
| Coding Ability | 0.3674 |
| DNA Sequence Corresponding to Peptide | ATGGTGACTAGCCTAAGTCTTTATAATTCG |
|
Conservation
|
|
|