Basic information for Gm32699-201-10aa-2
| Peptide Name | Gm32699-201-10aa-2 |
| Genome Position | chr13:17944926-17944955[+] |
| Species | Mouse |
| Peptide Sequence | MNVHSIKFAV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.8 |
| Relative Molecular Mass | 1307.52 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000113528;Gm32699 |
| Transcript ID/Name | ENSMUST00000221728;Gm32699-201 |
| Transcript Length | 1988 |
| Coding Ability | 0.5377 |
| DNA Sequence Corresponding to Peptide | ATGAATGTACACTCAATCAAGTTTGCAGTC |
|
Conservation
|
|
|