Basic information for Gm32828-202-10aa-1
| Peptide Name | Gm32828-202-10aa-1 |
| Genome Position | chr12:7525140-7525169[-] |
| Species | Mouse |
| Peptide Sequence | MLSKTLAFFV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.57 |
| Relative Molecular Mass | 1318.61 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000112323;Gm32828 |
| Transcript ID/Name | ENSMUST00000219198;Gm32828-202 |
| Transcript Length | 2111 |
| Coding Ability | 0.5505 |
| DNA Sequence Corresponding to Peptide | ATGCTTTCTAAGACTCTGGCATTCTTTGTA |
|
Conservation
|
|
|