Basic information for Gm33472-201-10aa
| Peptide Name | Gm33472-201-10aa |
| Genome Position | chr14:59049672-59049701[-] |
| Species | Mouse |
| Peptide Sequence | MPSSGFSGTA |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.1 |
| Relative Molecular Mass | 1103.19 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000114441;Gm33472 |
| Transcript ID/Name | ENSMUST00000224109;Gm33472-201 |
| Transcript Length | 2385 |
| Coding Ability | 0.4197 |
| DNA Sequence Corresponding to Peptide | ATGCCCTCTTCTGGCTTCTCAGGTACTGCG |
|
Conservation
|
|
|