Basic information for Gm33609-201-10aa
| Peptide Name | Gm33609-201-10aa |
| Genome Position | chr5:97148972-97149001[+] |
| Species | Mouse |
| Peptide Sequence | MTSIANCFYF |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1 |
| Relative Molecular Mass | 1358.57 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000104736;Gm33609 |
| Transcript ID/Name | ENSMUST00000198559;Gm33609-201 |
| Transcript Length | 2694 |
| Coding Ability | 0.4009 |
| DNA Sequence Corresponding to Peptide | ATGACCTCAATCGCAAATTGTTTTTACTTT |
|
Conservation
|
|
|