Basic information for Gm33948-203-10aa
| Peptide Name | Gm33948-203-10aa |
| Genome Position | chr18:28880060-28880089[+] |
| Species | Mouse |
| Peptide Sequence | MISAALLLTS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.91 |
| Relative Molecular Mass | 1181.41 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000117473;Gm33948 |
| Transcript ID/Name | ENSMUST00000234407;Gm33948-203 |
| Transcript Length | 628 |
| Coding Ability | 0.4411 |
| DNA Sequence Corresponding to Peptide | ATGATATCAGCGGCATTGCTATTAACAAGT |
|
Conservation
|
|
|