Basic information for Gm34059-201-10aa-2
| Peptide Name | Gm34059-201-10aa-2 |
| Genome Position | chr14:26324826-26324855[-] |
| Species | Mouse |
| Peptide Sequence | MSEEAAALVS |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.67 |
| Relative Molecular Mass | 1169.24 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000114753;Gm34059 |
| Transcript ID/Name | ENSMUST00000225697;Gm34059-201 |
| Transcript Length | 5711 |
| Coding Ability | 0.4181 |
| DNA Sequence Corresponding to Peptide | ATGTCTGAGGAGGCTGCGGCCTTGGTCTCT |
|
Conservation
|
|
|