Basic information for Gm34220-201-10aa
| Peptide Name | Gm34220-201-10aa |
| Genome Position | chr12:108792336-108792365[-] |
| Species | Mouse |
| Peptide Sequence | MHLGYCLVAE |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.96 |
| Relative Molecular Mass | 1297.5 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000114045;Gm34220 |
| Transcript ID/Name | ENSMUST00000223001;Gm34220-201 |
| Transcript Length | 2709 |
| Coding Ability | 0.3182 |
| DNA Sequence Corresponding to Peptide | ATGCATTTAGGTTATTGTTTAGTTGCTGAA |
|
Conservation
|
|
|