Basic information for Gm34240-201-10aa-2
| Peptide Name | Gm34240-201-10aa-2 |
| Genome Position | chr3:63457436-63457465[+] |
| Species | Mouse |
| Peptide Sequence | MRSFIYVSIQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.7 |
| Relative Molecular Mass | 1405.61 |
| Experimental Evidences | 1:m6A |
| lncRNA ID/Name | ENSMUSG00000104336;Gm34240 |
| Transcript ID/Name | ENSMUST00000192500;Gm34240-201 |
| Transcript Length | 1936 |
| Coding Ability | 0.3554 |
| DNA Sequence Corresponding to Peptide | ATGAGAAGTTTTATTTATGTTTCCATTCAG |
m6A
|
Conservation
|
|
|