Basic information for Gm34589-201-10aa-1
| Peptide Name | Gm34589-201-10aa-1 |
| Genome Position | chr14:102825463-102825492[-] |
| Species | Mouse |
| Peptide Sequence | MVACNCPAGQ |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.57 |
| Relative Molecular Mass | 1155.33 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000115816;Gm34589 |
| Transcript ID/Name | ENSMUST00000227101;Gm34589-201 |
| Transcript Length | 2979 |
| Coding Ability | 0.3995 |
| DNA Sequence Corresponding to Peptide | ATGGTTGCTTGTAATTGTCCTGCTGGCCAA |
|
Conservation
|
|
|