Basic information for Gm35769-201-10aa-2
| Peptide Name | Gm35769-201-10aa-2 |
| Genome Position | chr15:24890043-24890072[-] |
| Species | Mouse |
| Peptide Sequence | MLQGTFFING |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.73 |
| Relative Molecular Mass | 1289.5 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000115261;Gm35769 |
| Transcript ID/Name | ENSMUST00000228215;Gm35769-201 |
| Transcript Length | 4287 |
| Coding Ability | 0.3098 |
| DNA Sequence Corresponding to Peptide | ATGCTACAAGGCACTTTCTTCATTAATGGC |
|
Conservation
|
|
|