Basic information for Gm35996-201-10aa
| Peptide Name | Gm35996-201-10aa |
| Genome Position | chr15:25101059-25101088[-] |
| Species | Mouse |
| Peptide Sequence | MKFVHITSVL |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.28 |
| Relative Molecular Mass | 1336.64 |
| Experimental Evidences | 1:ribo |
| lncRNA ID/Name | ENSMUSG00000115174;Gm35996 |
| Transcript ID/Name | ENSMUST00000226274;Gm35996-201 |
| Transcript Length | 2318 |
| Coding Ability | 0.4698 |
| DNA Sequence Corresponding to Peptide | ATGAAGTTTGTACACATTACTTCAGTTCTC |
|
Conservation
|
|
|