Basic information for Gm36346-201-10aa
| Peptide Name | Gm36346-201-10aa |
| Genome Position | chr13:48108274-48108303[-] |
| Species | Mouse |
| Peptide Sequence | MFSLVKVKFV |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.53 |
| Relative Molecular Mass | 1359.68 |
| Experimental Evidences | 2:m6A,ribo |
| lncRNA ID/Name | ENSMUSG00000114457;Gm36346 |
| Transcript ID/Name | ENSMUST00000225626;Gm36346-201 |
| Transcript Length | 1247 |
| Coding Ability | 0.5213 |
| DNA Sequence Corresponding to Peptide | ATGTTTTCTTTGGTAAAGGTTAAATTTGTG |
m6A
|
Conservation
|
|
|