Basic information for Gm37094-201-10aa-1
| Peptide Name | Gm37094-201-10aa-1 |
| Genome Position | chr14:69498704-69498733[-] |
| Species | Mouse |
| Peptide Sequence | MPLTGIFSSI |
| Peptide Length | 10 |
| Unique | No (Gm20236-201-10aa-1) |
| Grand Average of Hydropathicity | 1.32 |
| Relative Molecular Mass | 1227.45 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000103720;Gm37094 |
| Transcript ID/Name | ENSMUST00000193352;Gm37094-201 |
| Transcript Length | 4540 |
| Coding Ability | 0.387 |
| DNA Sequence Corresponding to Peptide | ATGCCTCTTACGGGCATTTTCTCCAGCATA |
|
Conservation
|
|
|