Basic information for Gm37217-201-10aa-3
| Peptide Name | Gm37217-201-10aa-3 |
| Genome Position | chr1:71845605-71845634[-] |
| Species | Mouse |
| Peptide Sequence | MHPFLKLLII |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 1.64 |
| Relative Molecular Mass | 1386.73 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000102689;Gm37217 |
| Transcript ID/Name | ENSMUST00000194017;Gm37217-201 |
| Transcript Length | 3521 |
| Coding Ability | 0.3374 |
| DNA Sequence Corresponding to Peptide | ATGCATCCATTTCTCAAACTGCTTATTATT |
|
Conservation
|
|
|