Basic information for Gm37245-201-10aa-2
| Peptide Name | Gm37245-201-10aa-2 |
| Genome Position | chr3:93308925-93308954[-] |
| Species | Mouse |
| Peptide Sequence | MQDFHLIYKI |
| Peptide Length | 10 |
| Unique | Yes |
| Grand Average of Hydropathicity | 0.21 |
| Relative Molecular Mass | 1469.7 |
| Experimental Evidences | no |
| lncRNA ID/Name | ENSMUSG00000102476;Gm37245 |
| Transcript ID/Name | ENSMUST00000195137;Gm37245-201 |
| Transcript Length | 2713 |
| Coding Ability | 0.4261 |
| DNA Sequence Corresponding to Peptide | ATGCAGGATTTTCACTTGATTTATAAAATA |
|
Conservation
|
|
|